diff --git a/genom.py b/fastq_filter.py
similarity index 63%
rename from genom.py
rename to fastq_filter.py
index 2a6d89f..17f25d5 100644
--- a/genom.py
+++ b/fastq_filter.py
@@ -1,6 +1,12 @@
 import Bio.SeqIO
 import Bio.SeqUtils
 import os
+import click
+import logging
+import sys
+
+
+logger = logging.getLogger()
 
 
 def _in_bounds(value, bounds):
@@ -12,7 +18,7 @@ def _in_bounds(value, bounds):
 def filter_fastq(input_fastq: str, output_fastq: str,
                  gc_bounds: int | tuple = (0, 100),
                  length_bounds: int | tuple = (0, 2**32),
-                 quality_threshold: int = 0) -> dict:
+                 quality_threshold: int = 0):
     """
     Function filter_fastq(input_fastq, output_fastq, gc_bounds,length_bounds,
     quality_threshold) returns new file with fastq sequnces according to
@@ -37,17 +43,17 @@ def filter_fastq(input_fastq: str, output_fastq: str,
         default 0(scale Phred33). Reads with quality lower then
         treshold are decline.
     """
+    if not os.path.isfile(input_fastq):
+        logger.error("ERROR: Can not find file %s", input_fastq)
+        raise Exception(f'Can not find file {input_fastq}')     
+
     parent_dir = os.path.dirname(input_fastq)
     new_file_path = os.path.join(parent_dir, 'filtered', output_fastq)
-    '''Checks the name of new file is no the same as name of other files
-    in directory. If it is the same, returns 'Please insert other name
-    for output file, file is exsist'
-    '''
-    if os.path.isfile(new_file_path):
-        return 'Please insert other name for output file, file is exsist'
+
+    c = 0
     
     with open(new_file_path, "w") as output:
-        for rec in Bio.SeqIO.parse(input, "fastq"):
+        for rec in Bio.SeqIO.parse(input_fastq, "fastq"):
             seq = rec.seq
             quality = rec.letter_annotations["phred_quality"]
 
@@ -56,8 +62,9 @@ def filter_fastq(input_fastq: str, output_fastq: str,
             cond3 = sum(quality) / len(quality) >= quality_threshold
             if cond1 and cond2 and cond3:
                 Bio.SeqIO.write(rec, output, "fastq")
+                c += 1
 
-    return 'Filtering is complete'
+    logger.info("INFO from %s to %s filteren %s records", input_fastq, output_fastq, c)
 
 
 class BiologicalSequence:
@@ -130,3 +137,70 @@ def check_alphabet(self):
             if c not in valid:
                 return False
         return True
+
+
+
+@click.group()
+def main():
+    pass
+
+
+@click.command()
+@click.option("-q", "--quality", default=0, type=click.IntRange(min=0, max_open=True))
+@click.option("-gc-low", default=0, type=click.IntRange(min=0, max=100))
+@click.option("-gc-high", default=100, type=click.IntRange(min=0, max=100))
+@click.option("-len-low", default=0, type=click.IntRange(min=0, max=2**32))
+@click.option("-len-high", default=2**32, type=click.IntRange(min=0, max=2**32))
+@click.argument("infile")
+@click.argument("outfile")
+def filter(quality, gc_low, gc_high, len_low, len_high, infile, outfile):
+    try:
+        filter_fastq(infile, outfile, 
+                 gc_bounds=(gc_low, gc_high), 
+                 length_bounds=(len_low, len_high), 
+                 quality_threshold=quality)
+    except Exception as e:
+        print(e, file=sys.stderr)
+
+
+@click.command()
+@click.argument("cmd", type=click.Choice(["compl", "reverse", "complreverse", "transcribe"]))
+@click.argument("seq")
+def dna(cmd, seq):
+    x = DNASequence(seq)
+    if not x.check_alphabet():
+        print("invalid DNA sequence", file=sys.stderr)
+        return 1
+    if cmd == "compl":
+        print(x.complement())
+    elif cmd == "reverse":
+        print(x.reverse())
+    elif cmd == "complreverse":
+        print(x.reverse_complement())
+    elif cmd == "transcribe":
+        print(x.transcribe())
+
+
+@click.command()
+@click.argument("cmd", type=click.Choice(["compl", "reverse", "complreverse"]))
+@click.argument("seq")
+def rna(cmd, seq):
+    x = RNASequence(seq)
+    if not x.check_alphabet():
+        print("invalid RNA sequence", file=sys.stderr)
+        return 1
+    if cmd == "compl":
+        print(x.complement())
+    elif cmd == "reverse":
+        print(x.reverse())
+    elif cmd == "complreverse":
+        print(x.reverse_complement())
+
+
+main.add_command(filter)
+main.add_command(dna)
+main.add_command(rna)
+
+
+if __name__ == "__main__":
+    main()
\ No newline at end of file
diff --git a/fastq_filter_test.py b/fastq_filter_test.py
new file mode 100644
index 0000000..3a22385
--- /dev/null
+++ b/fastq_filter_test.py
@@ -0,0 +1,93 @@
+import unittest
+import fastq_filter as genom
+import tempfile
+import os
+
+
+class DnaTests(unittest.TestCase):
+    def test_check_alphabet(self):
+        dna = genom.DNASequence("ATGC")
+        self.assertTrue(dna.check_alphabet())
+        dna = genom.DNASequence("ATGCU")
+        self.assertFalse(dna.check_alphabet())
+
+    def test_complement(self):
+        dna = genom.DNASequence("ATGC")
+        compl = dna.complement()
+        self.assertEqual(compl.seq, "TACG")
+
+    def test_reverse(self):
+        dna = genom.DNASequence("ATGC")
+        rev = dna.reverse()
+        self.assertEqual(rev.seq, "CGTA")
+
+
+class RnaTests(unittest.TestCase):
+    def test_check_alphabet(self):
+        rna = genom.RNASequence("AUGC")
+        self.assertTrue(rna.check_alphabet())
+        rna = genom.RNASequence("ATGCU")
+        self.assertFalse(rna.check_alphabet())
+
+    def test_complement(self):
+        rna = genom.RNASequence("AUGC")
+        compl = rna.complement()
+        self.assertEqual(compl.seq, "UACG")
+
+    def test_reverse(self):
+        rna = genom.RNASequence("AUGC")
+        rev = rna.reverse()
+        self.assertEqual(rev.seq, "CGUA")
+
+
+class FilterTests(unittest.TestCase):
+    seq = """@SRR1363257.37 GWZHISEQ01:153:C1W31ACXX:5:1101:14027:2198 length=101
+GGTTGCAGATTCGCAGTGTCGCTGTTCCAGCGCATCACATCTTTGATGTTCACGCCGTGGCGTTTAGCAATGCTTGAAAGCGAATCGCCTTTGCCCACACG
++
+@?:=:;DBFADH;CAECEE@@E:FFHGAE4?C?DE<BFGEC>?>FHE4BFFIIFHIBABEECA83;>>@>@CCCDC9@@CC08<@?@BB@9:CC#######
+"""
+
+    def test_filter_no_file(self):
+        with self.assertRaises(Exception):
+            # where is no such file
+            genom.filter_fastq("---------------")
+
+    def test_filter_id(self):
+        name_in = tempfile.mktemp(suffix=".fastq")
+        name_out = tempfile.mktemp(suffix=".fastq")
+        try:
+            with open(name_in, "w") as f:
+                f.write(self.seq)
+            genom.filter_fastq(name_in, name_out)
+            self.assertTrue(os.path.isfile(name_out))
+
+            with open(name_out, "r") as f:
+                res = f.read()
+            self.assertTrue(res.strip() == self.seq.strip())
+        finally:
+            if os.path.isfile(name_in):
+                os.remove(name_in)
+            if os.path.isfile(name_out):
+                os.remove(name_out)
+        
+    def test_filter_all(self):
+        name_in = tempfile.mktemp(suffix=".fastq")
+        name_out = tempfile.mktemp(suffix=".fastq")
+        try:
+            with open(name_in, "w") as f:
+                f.write(self.seq)
+            genom.filter_fastq(name_in, name_out, length_bounds=(102, 1000))
+            self.assertTrue(os.path.isfile(name_out))
+
+            with open(name_out, "r") as f:
+                res = f.read()
+            self.assertTrue(res.strip() == "")
+        finally:
+            if os.path.isfile(name_in):
+                os.remove(name_in)
+            if os.path.isfile(name_out):
+                os.remove(name_out)
+
+
+if __name__ == "__main__":
+    unittest.main()
\ No newline at end of file
diff --git a/requirements.txt b/requirements.txt
new file mode 100644
index 0000000..73ad1d9
--- /dev/null
+++ b/requirements.txt
@@ -0,0 +1,2 @@
+biopython==1.85
+click==8.1.8