Skip to content
Open
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
72 changes: 42 additions & 30 deletions flexiplex.c++
Original file line number Diff line number Diff line change
Expand Up @@ -72,8 +72,10 @@ void print_usage(){
cerr << " -b sequence Append the barcode pattern to search for\n";
cerr << " -u sequence Append the UMI pattern to search for\n";
cerr << " Notes:\n";
cerr << " The order of these options matters\n";
cerr << " ? - can be used as a wildcard\n";
cerr << " The order of these options matters.\n";
cerr << " ? - can be used as a wildcard.\n";
cerr << " If the last pattern consists of only T or A, the polyT/A will be trimmed\n";
cerr << " until the first non-T(or A for polyA tails) character.\n";
cerr << " When no search pattern x,b,u option is provided, the following default pattern is used: \n";
cerr << " primer: CTACACGACGCTCTTCCGATCT\n";
cerr << " barcode: ????????????????\n";
Expand Down Expand Up @@ -196,8 +198,8 @@ unsigned int edit_distance(const std::string& s1, const std::string& s2, unsigne
// a targeted search in the region for barcode
// Sequence seearch is performed using edlib

Barcode get_barcode(string & seq,
unordered_set<string> *known_barcodes,
Barcode get_barcode(const string & seq,
const unordered_set<string> &known_barcodes,
int flank_max_editd,
int barcode_max_editd,
const std::vector<std::pair<std::string, std::string>> &search_pattern) {
Expand Down Expand Up @@ -233,13 +235,21 @@ Barcode get_barcode(string & seq,

//search for the concatenated pattern
EdlibAlignResult result = edlibAlign(search_string.c_str(), search_string.length(), seq.c_str(), seq.length(), edlibConf);
if(result.status != EDLIB_STATUS_OK | result.numLocations==0 ){
if(result.status != EDLIB_STATUS_OK || result.numLocations==0 ){
edlibFreeAlignResult(result);
return(barcode); // no match found - return
} //fill in info about found primer and polyT location
barcode.flank_editd=result.editDistance;
barcode.flank_start=result.startLocations[0];
barcode.flank_end=result.endLocations[0];

// check if last element of saerch_pattern is polyT
if (std::all_of(search_pattern.back().second.begin(), search_pattern.back().second.end(), [](char c) { return c == 'T'; })) {
barcode.flank_end = seq.find_first_not_of('T', result.endLocations[0]);
} else if (std::all_of(search_pattern.back().second.begin(), search_pattern.back().second.end(), [](char c) { return c == 'A'; })) {
barcode.flank_end = seq.find_first_not_of('A', result.endLocations[0]);
} else {
barcode.flank_end=result.endLocations[0];
}

// Extract sub-patterns from aligment directly
std::vector<long unsigned int> subpattern_lengths;
Expand Down Expand Up @@ -314,7 +324,7 @@ Barcode get_barcode(string & seq,
std::string exact_bc = seq.substr(
read_to_subpatterns[bc_index],
search_pattern[bc_index].second.length());
if (known_barcodes->size()==0 || (known_barcodes->find(exact_bc) != known_barcodes->end())){
if(known_barcodes.size()==0 || (known_barcodes.find(exact_bc) != known_barcodes.end())){
barcode.barcode=exact_bc;
barcode.editd=0;
barcode.unambiguous=true;
Expand All @@ -339,10 +349,10 @@ Barcode get_barcode(string & seq,
std::string barcode_seq = seq.substr(left_bound, max_length);

//iterate over all the known barcodes, checking each sequentially
unordered_set<string>::iterator known_barcodes_itr=known_barcodes->begin();
unordered_set<string>::const_iterator known_barcodes_itr=known_barcodes.begin();
unsigned int editDistance, endDistance;

for(; known_barcodes_itr != known_barcodes->end(); known_barcodes_itr++){
for(; known_barcodes_itr != known_barcodes.end(); known_barcodes_itr++){
search_string = *known_barcodes_itr; //known barcode to check against
editDistance = edit_distance(barcode_seq, search_string, endDistance, barcode_max_editd);

Expand All @@ -352,7 +362,6 @@ Barcode get_barcode(string & seq,
barcode.unambiguous = true;
barcode.editd = editDistance;
barcode.barcode = *known_barcodes_itr;

if (umi_index == -1) {
barcode.umi = "";
} else if (umi_index == bc_index + 1) {
Expand Down Expand Up @@ -396,16 +405,21 @@ vector<Barcode> big_barcode_search(string & sequence, unordered_set<string> & kn
vector<Barcode> return_vec; //vector of all the barcodes found

//search for barcode
Barcode result=get_barcode(sequence,&known_barcodes,max_flank_editd,max_editd, search_pattern); //,ss);
Barcode result=get_barcode(sequence,known_barcodes,max_flank_editd,max_editd, search_pattern); //,ss);
if(result.editd<=max_editd && result.unambiguous) //add to return vector if edit distance small enough
return_vec.push_back(result);
return_vec.emplace_back(result);

//if a result was found, mask out the flanking sequence and search again in case there are more.
if(return_vec.size()>0){
if (!return_vec.empty()) {
string masked_sequence = sequence;
for(int i=0; i<return_vec.size(); i++){
int flank_length=return_vec.at(i).flank_end-return_vec.at(i).flank_start;
masked_sequence.replace(return_vec.at(i).flank_start,flank_length,string(flank_length,'X'));
for(const auto &barcode : return_vec){
int flank_length;
if (barcode.flank_end == std::string::npos) {
flank_length = masked_sequence.length() - 1 - barcode.flank_start;
} else {
flank_length = barcode.flank_end - barcode.flank_start;
}
masked_sequence.replace(barcode.flank_start, flank_length,string(flank_length,'X'));
} //recursively call this function until no more barcodes are found
vector<Barcode> masked_res;
masked_res=big_barcode_search(masked_sequence,known_barcodes,max_flank_editd,max_editd, search_pattern); //,ss);
Expand Down Expand Up @@ -440,21 +454,16 @@ void print_stats(string read_id, vector<Barcode> & vec_bc, ostream & out_stream)
}
}

void print_line(string id, string read, string quals, ostream & out_stream){

//flag for read format
bool is_fastq=!(quals==""); //no quality scores passed = fasta

void print_line(const string& id, const string& read, const string& quals, ostream& out_stream) {
const char delimiter = quals.empty() ? '>' : '@';

//output to the new read file
if(is_fastq)
out_stream << "@" << id << "\n";
else
out_stream << ">" << id << "\n";
out_stream << read << "\n";
if(is_fastq){
out_stream << "+" << id << "\n";
out_stream << quals << "\n";
}
out_stream << delimiter << id << '\n'
<< read << '\n';

if (!quals.empty())
out_stream << '+' << id << '\n'
<< quals << '\n';
}

//print fastq or fasta lines..
Expand All @@ -472,6 +481,9 @@ void print_read(string read_id,string read, string qual,
string new_read_id=barcode+"_"+vec_bc.at(b).umi+"#"+read_id+ss.str();

// work out the start and end base in case multiple barcodes
if (vec_bc.at(b).flank_end == std::string::npos) {
continue;
}
int read_start=vec_bc.at(b).flank_end;
int read_length=read.length()-read_start;
for(int f=0; f<vec_bc.size(); f++){
Expand Down