RBPNFE

A python module for the evaluation of nucleosome positioning free energies.

Clone with all submodules

git clone --recurse-submodules -j8 https://github.com/eskoruppa/RBPNFE.git

Basic Function

Free energy calculations for individual positioning sequences (147bp) can be accessed via the NucFreeEnergy object.

import rbpnfe

params_model = 'MD'
hard_constraint = False

seq  = "ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCGAT"

shl_open_left = 0
shl_open_right = 0

nfe = rbpnfe.NucFreeEnergy(
    params_model = params_model,
    hardconstraint=hard_constraint,
    )


nout = nfe.eval(
    seq,
    shl_open_left = shl_open_left,
    shl_open_right = shl_open_right,
    use_correction = True
    )

print(f'Full Free Energy:         {nout["F"]:.2f} kT')
print(f'Fluctuation Contribution: {nout["F_fluctuation"]:.2f} kT')
print(f'Enthalpic Contribution:   {nout["F_enthalpy"]:.2f} kT')

Arguments

• params_model (str): Select the elastic model for the generation of stiffness and structure parameters:

  • md: Molecular Dynamics derived parameters from Lankas et al. [1]
  • crystal: Parameters from crystallographic data from Olson et al. [2]
  • cgna+: Parameters derived from cgNA+ via marginalization to rigid base pair model [3]
  • hybrid: md parameters for stiffness and crystal parameters for ground state.

• hardconstraint (bool): Select nucleosome binding model

  • True: Use hard constraint model
  • False: Use soft constraint model

• shl_open_left (int): select number of open superhelical locations counted from the left (default: 0)

• shl_open_right (int): select number of open superhelical locations counted from the right (default: 0)

• use_correction (bool): Apply translation correction in second iteration by expanding around compromise rotations deduced during first iteration (default: True)

[1] F. Lankaš, Jiří Šponer, Jörg Langowski, Thomas E. Cheatham, III, DNA basepair step deformability inferred from molecular dynamics simulations, Biophys. J, 85, 2872 (2003).

[2] W. K. Olson, A. A. Gorin, X. Lu, L. M. Hock, and V. B. Zhurkin, DNA sequence-dependent deformability deduced from protein–DNA crystal complexes, Proc. Natl. Acad. Sci. U.S.A. 95, 11163 (1998)..

[3] R. Sharma, A. S. Patelli, L. de Bruin, and J. H. Maddocks, cgNA+web: A visual interface to the cgNA+ sequence-dependent statistical mechanics model of double-stranded nucleic acids, J. Mol. Biol. 435, 167978 (2023)..